Show simple item record

dc.contributor.advisorTakiuchi, Elisabete, 1975-pt_BR
dc.contributor.authorFerreira, Caroline do Nascimento, 1999-pt_BR
dc.contributor.otherBarreiros, Marco Antonio Bacellar, 1967-pt_BR
dc.contributor.otherUniversidade Federal do Paraná. Setor Palotina. Curso de Graduação em Engenharia de Bioprocessos e Biotecnologiapt_BR
dc.date.accessioned2022-07-27T21:38:26Z
dc.date.available2022-07-27T21:38:26Z
dc.date.issued2022pt_BR
dc.identifier.urihttps://hdl.handle.net/1884/77379
dc.descriptionOrientador: Profa. Dra. Elisabete Takiuchipt_BR
dc.descriptionCoorientador: Prof. Dr. Marco Antônio Bacellar Barreirospt_BR
dc.descriptionMonografia (graduação) - Universidade Federal do Paraná, Setor Palotina, Curso de Graduação em Engenharia de Bioprocessos e Biotecnologiapt_BR
dc.descriptionInclui referências: p. 41-48pt_BR
dc.description.abstractResumo : os cyclovírus são um grupo de vírus com genoma de DNA fita simples circular de organização ambisenso descobertos em 2010 e desde então detectados em diferentes tipos de amostras de aves, mamíferos, insetos, aracnídeos e peixes dos seis continentes. No entanto, apesar da ampla gama de hospedeiros, os aspectos epidemiológicos e patogênicos da infecção viral permanecem pouco esclarecidos. Este trabalho foi realizado com o objetivo principal de desenhar e avaliar in silico conjunto(s) de primers para a detecção molecular, através de pela reação em cadeia da polimerase (PCR), de cyclovírus associados às aves, de maneira a ampliar as opções de detecção e contribuir com o esclarecimento da biologia dos cyclovírus. As 27 sequências de genoma completo de cyclovírus associadas a aves disponíveis em banco de dados foram submetidas à análise filogenética com Maximum Likelihood como método de inferência e o Generalized TimeReversible (GTR) como modelo evolucionário de substituição, utilizando 1000 réplicas de bootstrap como medida de confiança. Não se observou padrão de clados formados por hospedeiro, tipo de amostra, ano ou localização geográfica de coleta, mas sim um agrupamento irregular das sequências associadas, distribuído por todos os clados da árvore. Com a alta variabilidade genômica entre as sequências, foi selecionado, em função do percentual de identidade e da topografia filogenética, determinado conjunto de sequências para ser usado como template para o desenho e a avaliação in silico dos primers, realizados através do software Primer Blast. 15 pares de primers desenhados através da plataforma foram então avaliados in silico em função da região de anelamento, tamanho do amplicon, auto-complementaridade, auto-complementaridade na extremidade 3’, porcentagem de GC, bases próximas à extremidade 3’, temperatura de melting, e repetições de nucleotídeos de mesma base e o par CATCCCACCACTTGCCTCTC e TGGAGTCGTCAAACCCAGAG foi avaliado como o mais adequado.pt_BR
dc.format.extent1 recurso online : PDF.pt_BR
dc.format.mimetypeapplication/pdfpt_BR
dc.languagePortuguêspt_BR
dc.subjectFilogeniapt_BR
dc.subjectSeqüênciaspt_BR
dc.subjectVirus - Patogemicidadept_BR
dc.titleAnálise filogenética, desenho e avaliação in silico de primers para detecção de cycloviruspt_BR
dc.typeMonografia Graduação Digitalpt_BR


Files in this item

Thumbnail

This item appears in the following Collection(s)

Show simple item record